jennifer6776sab jennifer6776sab
  • 04-05-2018
  • Biology
contestada

A codon is a triplet base sequence in _____.

Respuesta :

elliegamer
elliegamer elliegamer
  • 16-11-2018

grad point


mRNA is the correct answer



Answer Link

Otras preguntas

the area of a rectangular garden is 38 1/4 square meters. the width of the garden is 4 1/2 meters. find the length of the garden
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
A flatbed truck is loaded 7,000 pounds of bricks. How many tons of bricks are on the truck?
Which sentence has two antecedents and one pronoun? Laurie likes to bake in her new oven. Cody and Aleena sold their car. My school does not have an October
The process of chemical cycling is known as a biogeochemical cycle because it A. takes places over a long period of time B. withdraws the
Please help me with this two step math problem! THANK YOU !!!!!!!!
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
Which is the best description of civil liberties? A. natural rights B. privileges C. rights guaranteed by law D. democratic goals E. trial procedures
Which of the following is NOT a form of formal debate? A. an argument B. policy debate C. parliamentary debate D. Lincoln-Douglass debate
i need help with this question