abbyH18
abbyH18 abbyH18
  • 03-05-2017
  • Mathematics
contestada

HELP!! Find the the surface area and round to the nearest tenth!

HELP Find the the surface area and round to the nearest tenth class=

Respuesta :

amorrison21
amorrison21 amorrison21
  • 03-05-2017
Well, first do height times width times depth, so 2 times six times eleven. so what's 12 times eleven? 132. Now multiply 132 times two and get 264. Your answer is 264.
Answer Link

Otras preguntas

Did feudalism create a stable form of government?
Solve 2x2 - 8x = -7 Which of the following is a solution of x2 + 5x = -2?
Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
what's the percentage of 1/8 ?
20 points People disagree whether the United States should have gone to war against Mexico. Should the United States have declared war? Opinions Please The Unit
In which section of his autobiography does Douglass show deep emotion? A.the expression of his affection for other slaves B. the narration of the first few y
How many combinations of 5 students can a teacher choose from 24 students? A. 5,100,480 B. 42,504 C. 7,962,624 D. 120
What statement best describes a republic?
Which additional word in the poem should be capitalized? Coyote In the night, it prowls alone hidden from view, Stalking prey. Before dawn, Coyote howls.