Sun9kvoRNicolle Sun9kvoRNicolle
  • 02-04-2017
  • Chemistry
contestada

What is the name of this ion: sn4 ?
a.tin (ii)
b.tin (iv)
c.scandium (iv)
d.scandium (ii)

Respuesta :

maddigascarthegreat
maddigascarthegreat maddigascarthegreat
  • 02-04-2017
Tin (iv), since the 4 tells us that the charge is 4 for tin. 
Answer Link

Otras preguntas

an explanation describe if a green pet mates with an orange pet, can they have any orange offspring.
How many years does an apple tree live useful?
On a new construction site, an electrician can install a new light fixture in 20 minutes. A project calls for 24 new fixtures to be installed on each of 4 floor
A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want
A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want
Aiden wrote a riddle: Five less than 1/5 times a number is same as the sum of the number and 1/3. Find the number
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
A student government organization is selling Christmas trees as a fundraiser. On Friday, they sold 5 noble fir trees and 3 douglas fir trees for a total of $420
Which is the best description of the events of A Midsummer Night's Dream? A. logical and tragic B. serious and historically accurate C. comical and fantasy-l
a antonym for biosphere