Seudónimo Seudónimo
  • 04-03-2017
  • Spanish
contestada

Las personas son tan groseras! ¿Nadie está de acuerdo?

Respuesta :

Alxyar
Alxyar Alxyar
  • 05-03-2017
Lo sé, ni siquiera responden correctamente!
Answer Link
Аноним Аноним
  • 05-03-2017
algunas depende del tipo de personas,no todas , todos pensamos diferentes
Answer Link

Otras preguntas

What are the qualities of a good topic? How will you ensure the topic you choose is relevant and interesting?
when Jefferson took office he did what
A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Which is one type of play that Shakespeare wrote? A. histories B. musicals C. passion plays D. burlesques Question Resources
which of these was a result of the treaty of Brest-Litovsk? A. The end of world war 1 B. Russia's withdrawal from the war C. The end of Austria-Hungrays war w
How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take
an explanation describe if a green pet mates with an orange pet, can they have any orange offspring.
Paulina works out with a 2.5 kilogram mass. What is the mass of the 2.5 kilogram mass in grams?
the bombing of Hiroshima and Nagasaki resulted in