AnarieJ150160 AnarieJ150160
  • 03-11-2022
  • Mathematics
contestada

Help me in these equation9^2 + b^2 = 15.81^2

Respuesta :

KeigenC383836 KeigenC383836
  • 03-11-2022

ANSWER

b = 13

EXPLANATION

We want to solve the equation:

[tex]9^2+b^2=15.81^2[/tex]

To do this, simplify the equation:

[tex]81+b^2=249.96[/tex]

Isolate b:

[tex]\begin{gathered} b^2=249.96-81 \\ b^2=168.96 \\ Find\text{ the square root of boths side:} \\ b=\sqrt[]{168.96} \\ b=13 \end{gathered}[/tex]

That is the answer.

Answer Link

Otras preguntas

The sterile material that is placed directly on a wound is termed​ the:
stuck i need help please
Help me please im about to give up
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
When did christianity become the official religion of the roman empire?
Which is a function of the placenta? it helps keep the embryo's temperature constant. it cushions the embryo from shock. it protects the embryo it nourishes the
Mi abuelo no es joven. Es _____
What is the First Language On world?
Which of the following can be a cause of social change?
Can you give me a short summary (a sentence or two) on Shakespeare’s Macbeth. And what it is.