ihateschool149 ihateschool149
  • 03-03-2022
  • History
contestada

What was the contribution made when George Washington left his role as president?

Respuesta :

hannahpalacios10 hannahpalacios10
  • 03-03-2022

Answer: During his Presidency George Washington helped lead the Contintental Army and led Americans during the American Revolution. The legacy he left was, shaping the standards for being a president and the executive branch.

Explanation:

Answer Link

Otras preguntas

In a standard dictionary, where can you find the key to pronunciation marks? A. In an appendix B. In the front of the dictionary C. At the bottom of each page D
Susan ........ (Run) to school because she was late.
lya took one hour to drive from his apartment to Philips Arena and back. The return drive took 8 minutes less than the trip to the arena. If x represents the ti
What is the range of function of y-1=(x+3)^2
What is the noun in the sentence below? The fish swims quickly. a. Quickly b. Fish c. The d. Swims
Companies raise funds to expand their business by
what is the geometric mean between 6 and 20?
Specify, "have" in these proposals is to shock or unstressed? 1) They have not lived here for years. 2) He has a house near the river. 3) Have you finished your
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Solve the equation -10 + 3x + 5x = -56 ? ??