isabmcgo
isabmcgo isabmcgo
  • 02-03-2022
  • Mathematics
contestada

Vincent drove 75 miles in 90 minutes.
How far could he drive at that rate in 1 hour?

Respuesta :

reyes289 reyes289
  • 02-03-2022
He can drive 50 miles. You first do 75/90 to see how many miles you get per minute. = .833333. You than multiply that to 60 minutes which is 50 miles
Answer Link
tpwklilliana12 tpwklilliana12
  • 02-03-2022
50
have a good day!!
Answer Link

Otras preguntas

an explanation describe if a green pet mates with an orange pet, can they have any orange offspring.
all 231 students in the math club went on a field trip. some students rode in vans ehich hold 7 students each and some students rode in buses which hold 25 stud
What is the range of function of y-1=(x+3)^2
one-third of the fish in Liam's fish tank were added today. Half of the other fish were a gift to Liam last week. the other 9 came from Liam's old fish tank.
Fossils are most commonly found in which type of rock?
The Earth has four main seasons: winter, spring, summer, and fall. Which of the following is a cause of seasonal changes on Earth? The Earth rotates. The
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Solve 2x2 - 8x = -7 Which of the following is a solution of x2 + 5x = -2?
how can you write 0.45 as fraction and a percentage ,please show work
Dalia has just enough money to buy either 6 pears and 20 oranges or 12 oranges and 11 pears. A pear costs $ 0.80. How much does an Orange cost ?