nno0100 nno0100
  • 03-05-2021
  • English
contestada

What is the mood and tone of the song “The sound of silence” by Disturbed

Respuesta :

helterbrande
helterbrande helterbrande
  • 03-05-2021

In "The Sound of Silence," the speaker feels he has an important message to deliver to the people entrenched in materialism, but they are too busy worshiping "the neon god" of culture to care. The speaker's tone can therefore be described as solemn and disappointed.

Hope this helps!

Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Give a recursive algorithm for finding the sum of the first n odd positive integers.
A flatbed truck is loaded 7,000 pounds of bricks. How many tons of bricks are on the truck?
Who was the Queen of England when Shakespeare first became known as a great playwright? A. Elizabeth I B. Mary Tudor C. Victoria D. Anne Boleyn
how do you say theatre in Spanish
How do I factor polynomials by grouping, step by step? 4x^2 - 19x+ 12
2ln(5x)=8 solve for x
How do I do trebuchet calculations????? Help me please
Angie takes a random sample of 100 students in her school and finds that 58% of the sample prefers art over music. There are 1,200 students in the school. Based
The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe