jahzeel09
jahzeel09 jahzeel09
  • 01-04-2021
  • Mathematics
contestada

Can anyone explain to me what to do here? I've been looking at this for like..days and...I still don't get it...

Can anyone explain to me what to do here Ive been looking at this for likedays andI still dont get it class=

Respuesta :

asmikatke
asmikatke asmikatke
  • 01-04-2021

Answer:

I think u have to find the distance.

Each point is given a distinct letter and like wise you have to count the distance between the two points given.

Step-by-step explanation:

Like, 1)distance between A and R when A = -11 and R = -9

their distance is 2 units.

Likewise, 2) RY = 6 units

3) EU = 7 units

4) WD = 5 units

5) EL = 12 units

Answer Link

Otras preguntas

How many combinations of 5 students can a teacher choose from 24 students? A. 5,100,480 B. 42,504 C. 7,962,624 D. 120
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Suppose 5\8 of the area of a garden is flowers. Zinnias cover 3\4 of the flower area. What fraction of the garden is zinnias?
Ms Graves gave her class 12 minutes to read. Carrie read 5/1/2 pages in that time. At what rate, in the pages per hour, did Carrie read?
an explanation describe if a green pet mates with an orange pet, can they have any orange offspring.
What are the factors of 6x + 24?
what rule does static electricity follow
Companies raise funds to expand their business by
Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12
Do you think then solid can undergo convection