shaguftanaseer31 shaguftanaseer31

01-02-2021
Mathematics

contestada

Volume?? Please help giving out brainliest and 12 points for answering

Volume Please help giving out brainliest and 12 points for answering class=

Respuesta :

Markoxmara Markoxmara

01-02-2021

Answer:

1395

Step-by-step explanation:

Since the Hight of the rectangular prism is 7 we can subtract that from 17 to get 10 for the Hight of the pyramid

volume of rectangular prism is 15·9·7=945

volume of pyramid is (15·9·10)/3=450

add

450+945=1395

Answer Link

Otras preguntas

A 500 g model rocket is resting horizontally at the top edge of a 40-m-high wall when it is accidentally bumped. The bump pushes it off the edge with a horizont

Mercury has two satellites. True False (I NEED THE ANSWER ASAP!

Colter Company prepares monthly cash budgets. Relevant data fromoperating budgets for 2017 are as follows: January February Sales 360,000 $400,000 Direct mat

What is one of the best principles of democracy

Where can you find cells that each have a cell well, a nucleus, and chloroplasts? A. There cells cannot be found. B. In plants C. In animals D. In both plants a

What's the best way to learn Spanish

How to solve 3v-12<5v+10

If I like geometry, then I like math. Choose the equivalent statement

Analyze the role of the Colombian Exchange in shaping patterns of colonization prior to 1607.

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template