RajuTamang RajuTamang
  • 03-01-2021
  • Mathematics
contestada

a
26
70º y 11c
2d
5e
7f
110°​

Respuesta :

tanzinakhatun838
tanzinakhatun838 tanzinakhatun838
  • 03-01-2021

Answer:

lol never see

Step-by-step explanation:

this kind o questions

Answer Link

Otras preguntas

It has been announced that 64% of all teenagers say they have a television in their bedroom. These findings came from a simple random sample of 1,000 teens. The
This low-lying plant that requires damp surfaces and does not have a system to transport water is a
What stretches north from Mozambique into syria
what's the square root of 36​
Describe what scientists mean when they refer to an ecological community such as that shared by the leopards and lions.
please solve with steps
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template
What is the answer to this
54t–6u Could some help me ?
Given a triangle with perimeter 63 cm, one side of which is 21 cm, and one of the medians is perpendicular to one of its angle bisectors. Find the lengths of al