dawnyay
dawnyay dawnyay
  • 01-09-2016
  • Mathematics
contestada

Solve y = mx + b for x

Respuesta :

MariReya
MariReya MariReya
  • 01-09-2016
y=mx+b
-b -b
--------------
-by= mx
-------------
m m

-by
------
m
Answer Link

Otras preguntas

which of the following countries did the u.s. lend-lease military equipment to A. Germany B. spain C.great britian D.italy
Let f(x) = 2x + 2. Solve f−1(x) when x = 4. a. 1 b.3 c. 4 d.10
The molarity of a solution that contains 0.50 moles of naoh in 200.0 milliliters of water is
I'm not sure how to do this I was not there that day they taught this and idk what some are and it was yesterday so..
Mrs. Collins is at the table with you and states that the fourth-degree graphs she has seen have four-real zeros. She asks you if it is possible to create a fou
I=$310 P=$1,000 t=5 years
What is the conjugate acid of clo3 −? 1. hclo3 2. clo3 − does not contain oh−, so it is not a base and thus cannot have a conjugate acid. 3. hcl 4. clo− 4 5. h
How many grams of potassium hydroxide are needed to prepare 600 ml of a.450 m koh solution?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
El clima de la costa Guatemalteca es tropical, es decir es ______________________.