melendezsergio melendezsergio

03-03-2020
Spanish

contestada

Choose the correct form of gustar.
A ella las flores.
Le gustan
le gusta
la gusta
se gusta

Respuesta :

yuktaxkulkarni yuktaxkulkarni

03-03-2020

Answer:

le gustan

Explanation:

Answer Link

alondra990 alondra990

03-03-2020

A ella le gustan las flores

Answer Link

Otras preguntas

In Sarah' speech about environmental movements, she states "recycling a single plastic bottle can conserve enough to energy to light a 60-watt lightbulb for six

In the job performance formula Performance=M+A+E, what does M stand for?

What were the social characteristics of the social and cultural revolutions of the 1960s and 1970s in the United States?

What position is the leader of the u.s. House of Representatives

better picture than the other one

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

Which statements serve as evidence that supports the theme of "The Story of the Fisherman”? Check all that apply. “I conjure you on your honour to tell me if y

What is the relationship between auxin and phototropism?

Which equation is the inverse of Y equals 2X squared -8

Vera spends all of her free time surfing. Today she was out on the waves for 2 hours. That is 60% less time than yesterday. How many hours did she spend surfing