carciaMofWaltz1
carciaMofWaltz1 carciaMofWaltz1
  • 01-07-2016
  • Social Studies
contestada

A sectarian school is run by
a. the department of education.
b. a religious church or denomination.
c. the state.
d. the parents.

Respuesta :

metchelle
metchelle metchelle
  • 09-07-2016
The answer to the question above is letter B. A sectarian school is run by a religious church or denomination. The term "sectarian" is emphasizes as a distinct belief of the particular group that runs the school with the help of the congregation delegated to assist or run the certain school.
Answer Link

Otras preguntas

What is the additive inverse of -4a
Failure to incorporate _______ can easily lead to _______. Would the answer be: citations, plagiarism?
Which body tissue or organ contains the most mitochondria?
when Jefferson took office he did what
Which is the best description of civil liberties? A. natural rights B. privileges C. rights guaranteed by law D. democratic goals E. trial procedures
a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
How has water influenced the development of civilization in Africa
What is the noun in the sentence below? The fish swims quickly. a. Quickly b. Fish c. The d. Swims
Write expression using the distributive property to find the product of 7 times 63