joetheman318 joetheman318

02-02-2020
History

contestada

In what way was the Mayan civilization diffrent from the Aztec and Inca civilizations

Respuesta :

isabellafredricks28 isabellafredricks28

02-02-2020

Answer:

The aztec and inca had large united empires but the maya didn't

Explanation:

Answer Link

Otras preguntas

First one that answers the answer get brainliest !!!!!!

Who is Apple (brand) trying to sell their product to? and why

Many different terms have been used to designate children who have extreme social interpersonal and/or intrapersonal problems. Which term have some pointed out

Where are the hot and dry climates of Africa?

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

If the velocity of a pitched ball has a magnitude of 47.0 m/s and the batted ball's velocity is 50.5 m/s in the opposite direction, find the magnitude of the ch

You are the CFO of a US firm whose wholly owned subsidiary in Mexico manufactures component parts for your U.S. assembly operations. The subsidiary has been fin

What is the best definition of “politics"? o the means by which people become citizens of a country the study of government and the rights and responsibilities

Help ASAP! WILL MARK BRAINLIEST! What must happen for light to change a material?

- Match the base pairs: 5’-AGGTCCG- 3’=