yuvashinii yuvashinii
  • 04-08-2019
  • Computers and Technology
contestada

what is the meaning of kod araham​

Respuesta :

Anand319
Anand319 Anand319
  • 04-08-2019

Explanation:

KOD (an initialism for Kids on Drugs, Kings Overdosed and Kill Our Demons) is the fifth studio album by American rapper J. Cole. ... The album also debuted at number-one in Australia, Canada, Ireland, and New Zealand.

Answer Link

Otras preguntas

what is the most common type of vegetation throughout Latin America
which point is in the solution set to the system of inequalities: y>2x-1 and y<1/2x+5
where are the three parts of an atom located
What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic
In which section of his autobiography does Douglass show deep emotion? A.the expression of his affection for other slaves B. the narration of the first few y
A generator stores electric current. Explain why you agree or disagree with this statement
In terms of weather, what kind of boundary does the line labeled X represent? A. occluded front B. stationary front C. cold front D. warm front
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
How much money, in dollars, does one mole of nickels represent?
Which term refers to the military dictators who took power in Latin America after the Spanish were driven out? A. conquistadores B. creoles C. caudillos D.