ninja9656
ninja9656 ninja9656
  • 02-03-2019
  • Mathematics
contestada

4z + 5 +2z =- 25 please help solve​

4z 5 2z 25 please help solve class=

Respuesta :

S1NGH
S1NGH S1NGH
  • 02-03-2019

Answer:

z=-5

Step-by-step explanation:

[tex]4z+5+2z=-25\\6z+5=-25\\6z=-30\\z=-5[/tex]

Answer Link

Otras preguntas

Why did new technology revolutionize communications
all other things being equal,the size of a population will decrease if
Describe these small intestine structures and their functions: intestinal glands -
the members of an animal community are usually similar in
The brackets are indicating a(n) _____ bond. the brackets are indicating a(n) _____ bond. hydrogen polar covalent single (nonpolar) covalent hydrophobic ionic
_______________ exposure to radiation can increase the risk of cancer.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Which ordered pair is a solution to the system of equations? {2x−y=−1 {2x−4y=8 A-(−2, −3) B-(8, 2) C-(1, 3) D-(7, −5)
How would you say good-bye to a friend whom you might not see for a long time? a. Hasta luego. b. Hasta pronto. c. Hasta ahora. d. ¡Adiós! e. Hasta mañana.
30.0 ml of an hf solution were titrated with 22.15 ml of a 0.122 m koh solution to reach the equivalence point. what is the molarity of the hf solution?