AWARDING BRAINLIEST describe how latitude and longitude coordinates are used to locate positions on Earth. What are some uses for a coordinate system like this?

Question

02-10-2018
Advanced Placement (AP)

contestada

AWARDING BRAINLIEST describe how latitude and longitude coordinates are used to locate positions on Earth. What are some uses for a coordinate system like this?

Respuesta :

Otras preguntas

The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe

Can someone explain the equation Q = M C delta T or Q = MCΔT Thanks!

Which powerful religious group often tried to close the theaters in Shakespeare's time? A. the Puritans B. the King's Men C. the Pilgrims D. the Jacobites

Jennie had $300. Then she spent $15 on a new shirt. What percent of the money does Jennie have left

what's the percentage of 1/8 ?

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

what is the position of 9 in the number 932,805? A. The ten-thousands place B. The hundred-thousands place C. The hundreds place D. The ones place

What is the adjective in the following sentence? The yellow sun hung brightly in the sky. a. Brightly b. Sun c. Yellow d. Hung

What Role Does the Sun Play in Producing Winds And Ocean Currents

mathisamazing mathisamazing · Answer 1 · 2018-10-02T23:15:27+02:00

mathisamazing mathisamazing

02-10-2018

When the location is visible the latitude would be the first number to say which has to be torwards the west side.Than,the longitude would be sayed,but has to be on the north side

Answer Link

*AWARDING BRAINLIEST* describe how latitude and longitude coordinates are used to locate positions on Earth. What are some uses for a coordinate system like this?

Respuesta :

Otras preguntas

AWARDING BRAINLIEST describe how latitude and longitude coordinates are used to locate positions on Earth. What are some uses for a coordinate system like this?