brysonbegay7905 brysonbegay7905
  • 04-07-2018
  • Arts
contestada

Russell simmons helped hip-hop artists invent _____.

Respuesta :

calayti
calayti calayti
  • 14-07-2018

Russell Simons then started Def Jam. He helped the hip hop artists invent this. He also did has his clothing line which is name as Phat Farm. Hope this is the right answer and would be of big help then.

Answer Link
Killer1771 Killer1771
  • 18-02-2020

Answer:  Fresh Fests on apex

Answer Link

Otras preguntas

Mrs.Henderson had 7/12dozen eggs in her refrigerator.Then she used 1/6 dozen eggs to make a cake.What fraction of a dozen is left?
What is the adjective in the following sentence? The yellow sun hung brightly in the sky. a. Brightly b. Sun c. Yellow d. Hung
What is the noun in the sentence below? The fish swims quickly. a. Quickly b. Fish c. The d. Swims
what is 0.00001267 is scientific notation
A pet store currently has a total of 45 cats and dogs. There are 7 more cats than dogs. Find the number of cats and dogs in the store. Write and solve a system
In terms of weather, what kind of boundary does the line labeled  X represent? A. occluded front B. stationary front C. cold front D. warm front
what are the 2 major types of cofactors?
What was religion like in Shang China?
what is the geometric mean between 6 and 20?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5